Sulaymon Eshkabilov

Last seen: Today | Active since 2019

research interests: vibrations, optimal control, system modeling and simulation, mechatronics... coding

Statistics

All

Content Feed

Answered
How to remove rows in a cell array?
Here is how you can do it: load('stations1.mat'); [Rs, Cs] = find(cellfun(@isempty, stations1)); stations1(Rs,:)=[];

ongeveer 20 uur ago | 1

Answered
How to code equation
Put both functions in plot() command or use hold on: m = 10e-3; a = 0.05; c = 0.1; x1 = @(t)(m/a)*exp(-(c/a)*t); x2 = @(t)...

ongeveer 23 uur ago | 0

Answered
index error,exceeding array dimensions.
Here is the corrected code: Vet = randi([-9,9], 1, 7); dim = numel(Vet)+1; V = ordina(Vet,dim) function Vet_ord = ordina(Vet...

1 dag ago | 0

Answered
Plotting as intregral the acceleration of a thing
This is how you can solve this exercise: N=100; T=11; dt=T/N; t=0:dt:T; F = [0 2 2 0 0 -2 -2 0]; % Accel...

1 dag ago | 0

| accepted

Answered
Matlab Simulink Arduino package
You would need MATLAB Support Package for Arduino Hardware - see Arduino Support from MATLAB - Hardware Support - MATLAB & Simul...

4 dagen ago | 0

Answered
How to code equation
A couple of small errors have been corrected: m = 10e-3; a = 0.05; c = 0.1; x = @(t)(m/a)*exp(-(c/a)*t); t = linspace(0,1...

4 dagen ago | 0

| accepted

Answered
Calculate Wavelength from velocity FFT
the Matlab fcn fft() computes the complex valued discrete Fourier Transform values. Thus, there is an error in your code. To ob...

4 dagen ago | 0

Answered
how to solve this error?
Here is completely fixed code. There were several errors with inconsistent variable names, setting and solving symbolic equation...

4 dagen ago | 0

Answered
How to pull values from a variable to set as a new variable/column
If understood your question correctly, to read this data file and sort out its content, readtable() would be a good strating poi...

5 dagen ago | 0

Answered
Why is the FOR loop in my program producing empty matrices?
Here is a bit edited and revised version of your code: Ne=8; Ni=2; re=rand(Ne,1); ri=rand(Ni,1); a=[0.02*ones(Ne,1); 0.02+0.0...

5 dagen ago | 0

Answered
Plot a sinusoidal signal from an x(t) equation
You need to plot this exercise this way: Ts = 1/8; %seconds t = 0:Ts:1; x = @(t) cos(2*pi*t-(pi/2)); XX=x(t); plot(t, XX, ...

5 dagen ago | 0

| accepted

Answered
How do I let the user enter an equation that is then able to be used in abs() calcualtions
Use this small change by specifying the input argument (x) in your code: x = 0:0.001:1; fprintf(1,'For example: cos(x)\n'); ...

5 dagen ago | 1

| accepted

Answered
Keep Simulink Data Inspector plot settings between simulation runs
You should try to run this: Simulink.sdi.clearPreferences to get back to the default settings of Simulink. See help doc here...

5 dagen ago | 0

Answered
Finding the maximum value in a single
Here is how you can get max values from 1-by-n-by-3 array from each channel exaplined with a simple example: PP(:,:,1) = round(...

6 dagen ago | 0

Answered
How to change the colorbar limits in Matlab?
clim does the job, e.g.: surf(peaks) clim([1.2 2.6]) colorbar

6 dagen ago | 0

Answered
Change values in vectors
V=[1,2,3,4,5,6] IDX = find(V>3); V(IDX)=2 %% ALT. Way: V=[1,2,3,4,5,6] V(V>3)=2

7 dagen ago | 0

Answered
how does zoomplot work?
1st of all zoomPlot() is a 3rd party function and is not part of MATLAB 2022b package or its toolboxes. Therefore, to see what c...

7 dagen ago | 0

| accepted

Answered
Limit of Decreasing Plot Size in MATLAB
You should try these options with 'units', 'pixels': set(gcf,'units', 'pixels','position', [700, 700, 50, 50])

7 dagen ago | 0

Answered
How to Extract X,Y,Z vectors from grid data?
If you data as given n-by-5, then you can just use surf(z), e.g.: data = rand(5,50); surf(data)

7 dagen ago | 0

Answered
%() Error: Illegal use of reserved keyword "end".
Here is the corrected part of your code: ... for ID_realz = 1:N rng('shuffle'); Mult_noise = (sigma*randn(size(I...

8 dagen ago | 0

Answered
I get an error that does not match the number of rows and columns in the program.
There were over dozens of size related errors, figure handle and uncommented comments in your code that are fixed. The main func...

8 dagen ago | 1

| accepted

Answered
Interpolating numerical function of many variables
You should consider here some sort of unit compatibe value for U, S, D, V. In other words, 100% (and 80%, 60%, 40%, 20%) open U ...

8 dagen ago | 0

Answered
My code does not work
Note also that there is one more undefined input vars in your function call. v_e is undefined, v_idex is computed from the given...

8 dagen ago | 0

Answered
for loop to read different files
There are a few different ways that can do this exercise. Here is one of them: clearvars FILE = fullfile('C:\Users\...', '*.tx...

8 dagen ago | 1

Answered
Plotting data from struct array
Here is one simple example: t1 = linspace(-pi, pi, 200); t2 = linspace(-pi, pi, 500); f1 = 2*sin(t1); f2 = 3*cos(t1); f3 ...

8 dagen ago | 0

Answered
How can I change the font size of the current axis?
There is one minor correction with one of the otptions proposed by @Mat Fig using fontsize() the unit has to be specified: x = ...

8 dagen ago | 0

Answered
How do I take my generated string outputs from for loop and return a list?
Here si the solution: a=[]; seq = 'ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACA' for i=1:3:numel(seq)-2 a = [a; (se...

10 dagen ago | 0

Answered
How to replace the values of a vector from desired location to its end?
The err in your code is with 0 in b's index that is not acceptable. Because b(0) does not exist. Which element of b vector are y...

13 dagen ago | 0

Answered
how to optimize a sweep for solving inequalities?
One of the possible ways to speed up your code is to get rid of display of resuts. Instead storing them, e.g.: syms ki kd i0 ...

13 dagen ago | 0

Answered
Solve a nonlinear function with one variable
It is quite simple to solve this exercise. Just use vpasolve(), e.g.: syms x Solution = vpasolve(x-x^2+2*sin(x)*(x-1)==0) An ...

13 dagen ago | 1

Sulaymon Eshkabilov

Statistics

Community

Community

MATLAB Answers

MATLAB Answers

Cody

Cody

Cody

MATLAB Answers

Cody

Cody

MATLAB Answers

MATLAB Answers

Content Feed