Problem 47513. DNA Sequence Assembly
DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show commentsProblem Recent Solvers3
Suggested Problems
-
Sum of diagonal of a square matrix
1600 Solvers
-
369 Solvers
-
Create logical matrix with a specific row and column sums
316 Solvers
-
Right Triangle Side Lengths (Inspired by Project Euler Problem 39)
1933 Solvers
-
357 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!