Addition of two DNA sequenc

6 views (last 30 days)
lilly lord
lilly lord on 11 Jun 2020
Commented: lilly lord on 13 Jun 2020
Hi, I have a problem in DNA addition
%%%%%%DNA addition
P_DNA1='ACAAGGGTTTAAACCCTTAC';
P_DNA2='TTTTGGGAAATGTGACATAT';
[m n]=size(P_DNA1);
mn=m*n;
d3=[];
for i = 1:mn
d3 = DNA_add('P_DNA1(i)','P_DNA2(i)');
end
where DNA_add is a function
  1 Comment
lilly lord
lilly lord on 11 Jun 2020
DNA_add function
function K = DNA_add(Q1,Q2)
if Q1=='A' && Q2=='A';
K = 'A';
elseif Q1=='A' && Q2=='G';
K = 'G';
elseif Q1=='A' && Q2=='C';
K = 'C';
elseif Q1=='A' && Q2=='T';
K = 'T';
elseif Q1=='G' && Q2=='A';
K = 'G';
elseif Q1=='G' && Q2=='G';
K = 'C';
elseif Q1=='G' && Q2=='C';
K = 'T';
elseif Q1=='G' && Q2=='T';
K = 'A';
elseif Q1=='C' && Q2=='A';
K = 'C';
elseif Q1=='C' && Q2=='G';
K = 'T';
elseif Q1=='C' && Q2=='C';
K = 'A';
elseif Q1=='C' && Q2=='T';
K = 'G';
elseif Q1=='T' && Q2=='A';
K = 'T';
elseif Q1=='T' && Q2=='G';
K = 'A';
elseif Q1=='T' && Q2=='C';
K = 'G';
elseif Q1=='T' && Q2=='T';
K = 'C';
end

Sign in to comment.

Accepted Answer

Sujay C Sharma
Sujay C Sharma on 11 Jun 2020
Edited: Sujay C Sharma on 11 Jun 2020
Hi,
There are a couple of minor issues with your implementation that is causing a problem.
  1. Your function is missing an end statement.
  2. Assuming that you wanted to send the ith character of P_DNA1 and P_DNA2 to the function DNA_add, the quotation marks are not needed.
  3. The variable d3 gets overwritten at each iteration of the loop rather than the result of DNA_add being appended to d3.
Here is the modified code which should resolve these issues:
P_DNA1='ACAAGGGTTTAAACCCTTAC';
P_DNA2='TTTTGGGAAATGTGACATAT';
[m n]=size(P_DNA1);
mn=m*n;
d3=[];
for i = 1:mn
d3 = [d3 DNA_add(P_DNA1(i),P_DNA2(i))];
end
function K = DNA_add(Q1,Q2)
if Q1=='A' && Q2=='A';
K = 'A';
elseif Q1=='A' && Q2=='G';
K = 'G';
elseif Q1=='A' && Q2=='C';
K = 'C';
elseif Q1=='A' && Q2=='T';
K = 'T';
elseif Q1=='G' && Q2=='A';
K = 'G';
elseif Q1=='G' && Q2=='G';
K = 'C';
elseif Q1=='G' && Q2=='C';
K = 'T';
elseif Q1=='G' && Q2=='T';
K = 'A';
elseif Q1=='C' && Q2=='A';
K = 'C';
elseif Q1=='C' && Q2=='G';
K = 'T';
elseif Q1=='C' && Q2=='C';
K = 'A';
elseif Q1=='C' && Q2=='T';
K = 'G';
elseif Q1=='T' && Q2=='A';
K = 'T';
elseif Q1=='T' && Q2=='G';
K = 'A';
elseif Q1=='T' && Q2=='C';
K = 'G';
elseif Q1=='T' && Q2=='T';
K = 'C';
end
end

More Answers (0)

Categories

Find more on Genomics and Next Generation Sequencing in Help Center and File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!