Decoding DNA sequence into binary

21 views (last 30 days)
I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you
  3 Comments
Meghashree G
Meghashree G on 23 Sep 2015
The output should be 01100011 01110010 01111001 01110000 01110100 01101111
( A=00 T=01 G=10 C=11)
Dabba Do
Dabba Do on 14 Feb 2018
Edited: Dabba Do on 14 Feb 2018
IF: every A matches to a T, THEN: the output for an A or a T is the same. The same is true of G and C they are a pair. So there are only two pairs, why not try defining each pair as a 1 or a 0. So if A and T = 1 and G and C = 0 then: the sequence TGACTCAGTGTTCAATCTATGCC would be: 101010101001101110111000. By coding each codon with a 1 and a 0 you are going to con-volute the Bits in your code and they work as pairs representing a single genetic Bit.

Sign in to comment.

Accepted Answer

James Tursa
James Tursa on 23 Sep 2015
Edited: James Tursa on 23 Sep 2015
One way:
s = 'TGACTCAGTCGTTCAATCTATGCC'; % Input DNA string
[~,x] = ismember(s,'ATGC'); % Convert the ATGC into indexes
c = {'00','01','10','11'}; % Numeric strings to convert the indexes into
result = cell2mat(c(x)); % Convert the indexes into the numeric strings

More Answers (4)

Bastien Chardonnens
Bastien Chardonnens on 23 Sep 2015
You can use
str = ('TGACTCAGTCGTTCAATCTATGCC');
[~,~,ind] = unique(double(str)-65);
dec2bin(ind-1)

Suresma Jena
Suresma Jena on 27 Aug 2017
i want to how to convert a DNA sequence into binary. ex- if x = ATGCAT then its binary sequence will be xA = 100010 xT = 010001 xG = 001000 xC = 000100
  6 Comments
Walter Roberson
Walter Roberson on 18 Sep 2017
s = fileread('NameOfTextFileGoesHere');
lakshmi boddu
lakshmi boddu on 8 Apr 2018
A pseudo random binary sequence of size 256 * 256 is generated with two 1 D logistic maps , from which 3-bit disjoint and consecutive binary sequences are extracted to choose DNA coding rule, as follows 000 ( 00-A,01-C 10-G,11-T) 001(00-A,01-G,10-C,11-T) 010(00-C,01-A,10-T,11-G) 011( 00-C ,01-T,10-A,11-G) 100( 00-G, 01-A,10-T,11-C) 101(00-G,01-T,10-A, 11-C) 110(00-T,01-C,10-G,11-A) 111( 00-T,01-G,10-C,11-A) . please help me sir how to implement in matlab

Sign in to comment.


Siyab Khan
Siyab Khan on 15 Jan 2019
Edited: Siyab Khan on 15 Jan 2019
Please also write code for DNA sequencig in 4 bits
via this given schema
4 2 1 0
N = 0 0 0 1 N represents the gap in DNA sequence
A = 0 1 0 0
T = 1 0 0 0
C = 0 0 1 0
G = 0 1 1 0

Khaled belkacemi
Khaled belkacemi on 4 Apr 2022
Edited: Khaled belkacemi on 4 Apr 2022
Hello,can someone help me to do the code for this situation? example of input data:0121212002202021101110002
and i want to code my data as this array

Categories

Find more on Genomics and Next Generation Sequencing in Help Center and File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!