Main Content

randsample

R2026b

Description

y = randsample(n,k) returns k values sampled uniformly at random, without replacement, from the integers 1 to n.

example

y = randsample(population,k) returns a vector of k values sampled uniformly at random, without replacement, from the values in the vector population.

example

y = randsample(___,replacement) returns a sample taken with replacement if replacement is true, or without replacement if replacement is false. Specify replacement following any of the input argument combinations in the previous syntaxes.

example

y = randsample(n,k,true,w) uses a vector of nonnegative weights, w, whose length is n, to determine the probability that an integer i is selected as an entry for y.

y = randsample(population,k,true,w) uses a vector of nonnegative weights, w, of the same length as the vector population, to determine the probability that a value population(i) is selected as an entry for y.

example

y = randsample(s,___) uses the stream s for random number generation. The option s can precede any of the input arguments in the previous syntaxes. s is a member of the RandStream class.

example

Examples

collapse all

Draw a single value from the integers 1 through 10.

n = 10;
x = randsample(n,1)
x = 
9

Create the random seed for reproducibility of the results.

s = RandStream('mlfg6331_64'); 

Draw a single value from the vector [10:20].

population = 10:20;
y = randsample(s,population,1)
y = 
17

Create the random number stream for reproducibility.

s = RandStream('mlfg6331_64');

Choose 48 characters randomly and with replacement from the sequence ACGT, according to the specified probabilities.

R = randsample(s,'ACGT',48,true,[0.15 0.35 0.35 0.15])
R = 
'GGCGGCGCAAGGCGCCGGACCTGGCTGCACGCCGTTCCCTGCTACTCG'

Create the random number stream for reproducibility.

s = RandStream('mlfg6331_64'); 

Draw five values with replacement from the integers 1:10.

y = randsample(s,10,5,true)
y = 5×1

     7
     8
     5
     7
     8

Input Arguments

collapse all

Upper limit of the range (1 to n) from which to sample, specified as a positive integer. By default, randsample samples uniformly at random, without replacement, from the values in the range 1 to n.

Data Types: single | double

Input data from which to sample, specified as a vector. By default, randsample samples uniformly at random, without replacement, from the values in population. The orientation of y (row or column) is the same as that of population.

If population is a numeric vector containing only nonnegative integer values, and population can have the length 1, then use y = population(randsample(length(population),k)) or y = datasample(population,k,'Replace',false) instead of y = randsample(population,k).

Example: y = randsample([50:100],20) returns a vector of 20 values sampled uniformly at random, without replacement, from the population vector consisting of integers from 50 to 100.

Data Types: single | double | logical | char | string | categorical

Number of samples, specified as a positive integer.

Example: randsample(20,10) returns a vector of 10 values sampled uniformly at random, without replacement, from the integers 1 to 20.

Data Types: single | double

Indicator for sampling with replacement, specified as either false or true.

Example: randsample(10,2,true) returns two values with replacement from the integers 1 to 10.

Data Types: logical

Sampling weights, specified as a vector of nonnegative scalar values. The length of w must be equal to the range of integers to sample or the length of population. The vector w must have at least one positive value. If w contains negative values or NaN values, randsample displays an error message. The randsample function samples with probability proportional to w(i)/sum(w). Usually, w is a vector of probabilities. The randsample function supports specifying weights only for sampling with replacement.

Example: [0.1 0.5 0.35 0.46]

Data Types: single | double

Random number stream, specified as the MATLAB default random number stream or RandStream. For details, see Create and Control Random Number Streams.

Example: s = RandStream('mlfg6331_64') creates a random number stream that uses the multiplicative lagged Fibonacci generator algorithm.

Output Arguments

collapse all

Sample, returned as a vector or scalar.

  • If k = 1, then y is a scalar.

  • If k > 1, then y is a k-by-1 vector.

Alternative Functionality

To sample data randomly, with or without replacement, use datasample.

Extended Capabilities

expand all

Version History

Introduced before R2006a