getInfo

Class: BioMap

Retrieve information for single element of BioMap object

Syntax

Info = getInfo(BioObj, Element)

Description

Info = getInfo(BioObj, Element) returns Info, a tab-delimited string containing information about a single element in BioObj, a BioMap object.

Input Arguments

BioObj

Object of the BioMap class.

Element

One of the following to specify one element in BioObj:

  • Scalar specifying an element index

  • Logical vector

  • String containing a valid sequence header

Output Arguments

Info

Tab-delimited string containing information about a single element in BioObj, a BioMap object. The string contains the information from the following properties in order:

  • Header

  • Flag

  • Start

  • MappingQuality

  • Signature

  • Sequence

  • Quality

Examples

Construct a BioMap object, and then retrieve information for the second element in the object:

% Construct a BioMap object from a SAM file 
BMObj1 = BioMap('ex1.sam');
% Retrieve information for the second element in the object
element2Info = getInfo(BMObj1, 2)
element2Info =

EAS54_65:7:152:368:113	73	3	99	35M	
CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT	
<<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):
Was this topic helpful?